Volume 5, Issue 4, April 2014 Edition
Publication for Volume 5, Issue 4, April 2014 is in-process.
 Register for IJSER Research Forum
IJSER Xplore Research Paper Database
Pages
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
Development Of A Field-Portable Digital Potentiostat[Full-Text ] Oluwole O.O, Adegoke T.O. and Ajide.O.OThe use of potentiostats for corrosion rate studies and activation polarization is very crucial because the weight loss method is limited in corrosion studies. However,commercial potentiostats are expensive for most end users. For these reasons, it was desirable to design and build an inexpensive field-portable potentiostat to interface with electrochemical cell.This paper presents theprocedure and design principles of a portable, digital and inexpensive potentiostat, its construction and testing.PROTEUS® software was used in the design of the different components of the potentiostatand simulation of the potentiostat circuit based on considerations of potentiostatic control and an output current of 0.01 to 1A. The potentiostat was tested in a corrosion cell in which a mild steel working electrode (WE) was immersed in 5%NaCl solution. Ag/AgCl reference electrode(RE) was used as well as a Pt counter electrode(CE). An open circuit potential (OCP) of -0.22 V, exchange current density (iomild steel,Fe/Fe2+) of 1.5 x 10-6 A/cm2, standard potential of mild steel (EOmildsteel) of – 0.42V and corrosion penetration rate(CPR) at io of 9.18 x 10-7cm/hr and Taffel ? value of 0.13 V was obtained for mild steel in 5% NaCl solution. The values of OCP,io,EO ,CPR and ? were consistent with values obtained from literature.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Synthesis, Reactions and Characterization of bis-thieno[2,3-b]-pyridine-2-carbohydrazide Derivative[Full-Text ] Fawzy A. Attaby and Ahmed A. M. ElreedyReaction of diethyl 4,4'(1,4-phenylene)bis(3-amino-5-acetyl-6-methylthieno[2,3-b]pyridine-2-carboxylate (1) with hydrazine hydrate afforded the 4,4’-benzene-1,4-diylbis(5-acetyl-3-amino-6-methylthieno[2,3-b]pyridine-2-carbohydrazide) (3). The structure of 2 was inferred through independent synthetic reaction of diethyl 2,2’-{1,4-phenylenebis[3-cyano-5-acetyl-6-methylpyridine-4,2-diyl)thio]}diacetate 2 under the same applied reaction conditions. On the other hand, reaction of 3 with formic acid, acetic anhydride, triethylorthoformate, acetic acid, ethyl acetoacetate, diethylmalonate, phenylisothiocyante and acetylacetone aiming to build up pyrimidine, pyrazole or oxadiazole on the ring system of 3. Structures of all newly synthesized heterocyclic compounds in the present study were confirmed by considering the data of IR, 1H NMR, mass spectra as well as that of elemental analyses.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Isolation and partial characterization of Cronobacter sakazakii by 16S rRNA sequence analysis isolated from milk of dairy cows with Mastitis in Chikmagalur, Karnataka, INDIA[Full-Text ] Vineeth B, Priyanka B, Ramesh B S, Makari Hanumanthappa K, Vinay Suvarna M N and Vivek ChandramohanMastitis is a chronic inflammation of milk glands which is caused by the bacteriological variations in the milk and other changes in the glandular tissue. Mastitis occurs throughout the world wherever dairy farms are found. Cronobacter sakazakii is one of the causative organism and also it is known as Enterobacter sakazakii. Cronobacter sakazakii enters the cattle through the udder, where the cattle are reared in the unhygienic condition. The bacteria were isolated from Mastitis infected raw milk around the Chikmagalur District. Bacteria were isolated with the standard protocols and were maintained in Lowry broth (LB) media. All the isolates were subjected to RAPD analysis. Further DNA of the bacteria was isolated by CTAB method and subjected to 16s ribosomal sequence analysis using 16S rRNA FU8 universal primers (16s rRNA F-5’AGAGTTTGATCCTGGCTCAG 3’, 16s rRNA R-5’ACG GCTACCTTGTTA3’) and phylogenetic analysis were used to molecular relatedness of the isolated animal pathogenic bacteria.16S rRNA sequences were submitted to GenBank, NCBI and accession number was allotted. The obtained 16S rRNA sequences were subjected in-silico analysis by genomics workbench software for Sequence information, atomic composition, nucleic acid distribution, nucleotide distribution, histogram and secondary structure prediction. The findings of this research greatly anticipated for the identification and characterization of the animal pathogen Cronobacter sakazakii was first time reported in Chikmagalur, Karnataka, India.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
In-vitro antimicrobial activity and preliminary phytochemical investigation of Anisomeles malabarica from Western Ghats, Karnataka[Full-Text ] Vinod G, Makari Hanumanthappa K, Vinay Suvarna M N and Rashmi T SAnisomeles malabarica is a traditional medicinal plant distributed throughout Southern India. The aim of this study deals with the investigation of preliminary bioactive phytochemicals present in the leaves extracts obtained by analytical standard hexane and ethanol solvents. The phytochemicals were analysed such as alkaloids, flavonoids, saponins, tannins and terpenoids from both the leaves extracts. This study also extends to evaluate the antimicrobial activity of Anisomeles malabarica leaves extracts. The in vitro antimicrobial activity was performed by agar well diffusion method against the clinically important multi drug resistant bacterial strains viz., Staphylococcus aureus (NCIM 2492), Bacillus subtillis (NCIM 2439) and Klebsiella pneumoniae (NCIM 2719) with the concentration of extracts ranged from 25 to 75µL. It has shown the concentration dependent antimicrobial activity (MIC). This study shows the powerful antimicrobial activity against Staphylococcus aureus and Klebsiella pneumoniae bacterial strains with maximum inhibitory zone compared with standard antibiotic drug tetracycline.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
COMPARATIVE ANALYSIS OF LINEAR PROBING, QUADRATIC PROBING AND DOUBLE HASHING TECHNIQUES FOR RESOLVING COLLUSION IN A HASH TABLE[Full-Text ] Saifullahi Aminu Bello, Ahmed Mukhtar Liman, Abubakar Sulaiman Gezawa, Abdurra’uf Garba, Abubakar AdoHash tables are very common data structures. They provide efficient key based operations to insert and search for data in containers. Like many other things in Computer Science, there are tradeoffs associated to the use of hash tables. They are not good choices when there is a need for sort and select operations. There are two main issues regarding the implementation of hash based containers: the hash function and the collision resolution mechanism. The hash function is responsible for the arithmetic operation that transforms a particular key into a particular table address. The collision resolution mechanism is responsible for dealing with keys that hash to the same address. In this research paper ways by which collision is resolved are implemented, comparison between them is made and conditions under which one techniques may be preferable than others are outlined.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Enforcing Cloud Security from Broker using Delegated Access Control[Full-Text ] Aashutosh Bhadauriya, Pushkar Hagawane, Swapnil Jagdale, Tejas GujarPublic clouds are most vulnerable to unauthorized access. Information security in the public clouds can be an issue if the privacy is not preserved. Unauthorized users can access the data and manipulate it which could make the data useless. Existing systems use fine grained encryption approach for providing fine grained access control to maintain the confidentiality of data hosted in the public clouds. In existing systems data owners are responsible for encrypting data before uploading to cloud and re-encrypting data whenever the user credentials change. This makes existing approaches inefficient as data owner suffer from high communication and computation cost. An efficient approach will delegate the authority of fine grained encryption of data towards the cloud still assuring the confidentiality of data. Proposed system will address this requirement of delegation by providing a two-layer encryption. Cloud will perform fine grained encryption on data while data owners will perform coarse grained encryption on data hosted in cloud. Performing two layer encryption can be an issue if the access control policies (ACP’s) are not decomposed properly. We propose an efficient algorithm for decomposition of ACP’s.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Biophysical limitations on the measurement of the biological permittivity using TDR method[Full-Text ] Adnen RAJHIIn order to measure accurately the broadband frequency dependent of the complex biological permittivity, the dielectric measuring method by the time domain reflectometry method (TDR) using two types of sample holders is presented; the biological medium exhibit different physical behaviours when excited by an EM field; these could be source of errors in the measuring phase and can lead to some limitations. Indeed we can classify the permittivity measurement errors in two types
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Facile bifunctional dyeing of polyester fabrics with new antibacterial ß-Oxoalkanenitriles disperse dyes.[Full-Text ] Tarek Abou Elmaaty, Fathi El-Taweel, Eman Abd El-Aziz, Mohamed Yusif and Satoko Okubayashi.A series of ß-Oxoalkanenitriles disperse dyes were synthesized. The structures of all dyes were established by elemental analysis and spectral studies (IR, 1H-NMR, MS). These dyes were applied to polyester fabrics as disperse dyes by using conventional dyeing method. Fabrics dyed with the dyes under study furnished generally deep and bright intense hues ranging from light yellow to orange. Fastness properties of dyed polyester samples were measured and the position of color in CIELAB coordinates (L*, a*, b*, H*, C*) was assessed. Finally, the antibacterial activity of the synthesized dyes and dyed samples was also evaluated qualitatively according to AATCC test method (147-1988).
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
BER analysis of mimo stbc using various equalization techniques[Full-Text ] Farha siddiquiToday is an era of any time any where always on applications meaningfully high speed and high data rate communicating systems. IN todays digital world our communicating systems such as mobile phone ,wireless systems (including LANand bluetooth)3G ,4G all are expected to support a large area of coverage provide higher data rate transmission reduces bit error rate in addition provide high quality multimidea services such as good high quality voice ,video,image and text data. As the radio spectrum in finite so does our demand is minimum usage of spectrum resources and with little transmitted power..MIMO is considered to be the key technology for wireless communication systems.MIMO is promising technology which sounds to to provide higher data rate ,good quality of service with lower bit error rate.MIMO(stands for multiple input multiple output systems) which employs multiple transmit and receive antenna to increase system capacity ,throughput and performance.AS the wireless transmission media is atmosphere(anolog) there are different atmospheric layers as the signal travels from one layer to another there appears to have a degrading effect in quality of signal strength this is termed to be fading effect(i;e)signal is said to be fadded,another issues is when signal moved from multiple path if effect the signal in phase,delay,Doppler Frequency,and channel impulse response all effect the signal i;e the signal which arrive at the receiver is faded.This phenomenon is refered to as fading.Diversity analysis is done to combat the fading effects.Before the signal reaches the reciever and gets demodulated,some equalisation techniques must be perform on the signal so that if combat the effect of fading and i.s.i(inter symbolic interference)which is the main factors which are responsible for (BER).IN this paper different equalisation techniques have been introduced which helps in mitigating the (BER).
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Experimental Investigation of Ferrocement Panel Under Flexure By Using Expanded Metal Mesh[Full-Text ] Darshan. G. Gaidhankar, Dr. Ankur. A. KulkarniThe present study describes the results of testing flat ferrocement panels reinforced with different number of wire mesh layer and variation in panel thickness. The main objective of these experimental tests is to study the effect of using different numbers of wire mesh layers and thickness variation on the flexural strength of flat ferrocement panels and to compare the effect of varying the number of wire mesh layers on the ductility and the ultimate strength of this type of ferrocement structure. In this study, all the specimens were divided into four groups to investigate the strength and behavior of ferrocement flat panels subjected to two-point loading. Forty eight Ferro-cement elements were constructed and tested. The used number of wire mesh layers is single, two, three and four layers; also thicknesses of panels are 20mm, 30mm, 40mm.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Frequent motorcycle crashes: An issue of serious Public Health concern in the Wa Municipality of Upper West Region, Ghana.[Full-Text ] Godfred Etsey Sebiawu, Emmanuel Aikins, George Okyere Dokyi.Road traf?c injuries and fatalities constitute a major public health and development crisis in Ghana. Motorcycle crashes and the related costs of personal injuries are issues of public health concern in the Wa Municipality and across the nation as a whole. There were about 778 injuries and fatalities from various road traffic accident underreported to Motor Traffic and Transport Unit, MTTU, of the Ghana Police Service in the Wa Municipality between 2008 and 2013, which resulted in millions of cedis in hospital charges and damages to the State due to tremendouse increase of 450% in annual registration of motorcycles from 2007 to 2013 at the Wa Office of Drivers and Vehicle Lisensing Authority,DVLA . The increase in motorcycles in the Municipality also indicate a corresponding increase in road traffic accidents. The study was done at Wa Municipality and the gender distribution of the respondents indicate males dominate in the use of motorcycles as means of transport in Wa metropolis and with most within the age of 20-39 years. It also suggests that most of the respondents considered the use of motorcycle to be very cheap, easy to learn, easy to maintain and very attractive for work, school and leisure. The study also shows that most of the motorists comply with traffic regulations, ensure monthly maintenance and also admitted they cannot do basic repair works on their motorcycles. Almost all the respondents claimed to be aware of Universal Crash Helmet law, law governing registration of motorcycle, riding of motorcycle by minors, riding under the influence of alcohol and the consequence of overloading, over-speeding and the essence of taking personal accident insurance policy.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Collaborative E-Commerce using Near Field Communication (NFC) Technology[Full-Text ] Manasi KulkarniThe purpose of this paper is to develop an optimized application which will enable mobile payment considering the NFC as the base technology. The test implication of this technology suggests that NFC supported E-commerce system can bring value for customers in terms of ease and security.This is due to the fact that majority of the phones in the market are smartphones with 25% recent phones being NFC enabled devices.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
A New Biphase Coding LFM for Pulse Compression Radar[Full-Text ] Ahmed Ramadan, Moustafa El-Hoshy, and Alaa El-Din Sayed HafezLinear Frequency Modulation (LFM) waveform becomes widespread in modern pulse compression radar systems in order to improve its target range resolution capability. Conventional LFM based on varying the waveform frequency linearly within the radar pulse width which leads to high Auto Correlation Function (ACF) with limited compression ratio (CR) and side lobe level (SLL). This paper proposed Optimized Biphase Pulse Compression Codes (OBPCC) with the LFM waveform. Frequency and phase coding have been used to achieve optimum (SLL) and (CR) using Genetic algorithm (GA). The results compare the ACF for both LFM and phase coded (PCLFM). Set of codes are generated for code length of 51 with frequency modulation index from 0.002 to 0.009. Peak sidelobe level from -18.89 dB to -19.33 dB is achieved. The results obtained show superiority of PCLFM over the conventional LFM which improves the compression ratio by 9.95 times the conventional LFM.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
An Overview on Implementation of MIMO OFDM Transceiver for 802.11n[Full-Text ] Amar Mandekar, S.D. Patil, D.S. AroraThe best approach for real time application to achieve high throughput and network capacity for fourth generation wireless local area networks is to combine MIMO wireless technology with OFDM. This paper first focuses on 802.11n standard, MIMO-OFDM system. This paper further reviews different work done on implementation of MIMO-OFDM transceiver for 802.11n standard.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Correlates of Adoption of Vegetable by Tribal Farmers of Keonjhar District of Odisha[Full-Text ] Bibhu Santosh BeheraThe present study was under-taken with a view to find out the socio-economic profile of tribal vegetable farmers; to find out the relationship between the socio-economic characteristics of the respondents with the vegetable adoption and rejection. Further an attempt was made to identify the constraints that hinder the vegetable adoption by the tribal farmers. Accordingly Suggestions were collected from field level & formulation of suitable strategies for comprehensive study in near future.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
EFFECT OF SUCTION ON THIN FILM FLOW OF A THIRD GRADE FLUID IN A POROUS MEDIUM DOWN AN INCLINED PLANE WITH HEAT TRANSFER[Full-Text ] Gbadeyan J.A, Idowu A. S, Okedayo, G. T, Ahmed L. O and Lawal O.WIn this paper, we have investigated the effect of suction on thin film flow of a third grade fluid in a porous medium down an inclined plane in presence of heat transfer. The method of regular and homotopy perturbations were used to obtain the solutions of the non-linear equations arising from the problem and the results presented graphically. The results revealed that both methods are in closed agreement as both almost have the same solution. Also, it was observed that as suction parameter increases, the temperature decreases, while increasing porosity parameter decreases the fluid velocity.
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Pages
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
|